Mock Version: 6.0 Mock Version: 6.0 Mock Version: 6.0 ENTER ['do_with_status'](['bash', '--login', '-c', '/usr/bin/rpmbuild -bs --noclean --target aarch64 --nodeps /builddir/build/SPECS/bowtie.spec'], chrootPath='/var/lib/mock/epel8-build-58174987-6562882/root'env={'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'}shell=Falselogger=timeout=201600uid=1000gid=425user='mockbuild'unshare_net=TrueprintOutput=Falsenspawn_args=['--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.k0slf5k0:/etc/resolv.conf']) Executing command: ['bash', '--login', '-c', '/usr/bin/rpmbuild -bs --noclean --target aarch64 --nodeps /builddir/build/SPECS/bowtie.spec'] with env {'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'} and shell False Building target platforms: aarch64 Building for target aarch64 Wrote: /builddir/build/SRPMS/bowtie-1.2.3-2.el8.src.rpm Child return code was: 0 ENTER ['do_with_status'](['bash', '--login', '-c', '/usr/bin/rpmbuild -bb --noclean --target aarch64 --nodeps /builddir/build/SPECS/bowtie.spec'], chrootPath='/var/lib/mock/epel8-build-58174987-6562882/root'env={'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'}shell=Falselogger=timeout=201600uid=1000gid=425user='mockbuild'unshare_net=TrueprintOutput=Falsenspawn_args=['--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.k0slf5k0:/etc/resolv.conf']) Executing command: ['bash', '--login', '-c', '/usr/bin/rpmbuild -bb --noclean --target aarch64 --nodeps /builddir/build/SPECS/bowtie.spec'] with env {'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'} and shell False Building target platforms: aarch64 Building for target aarch64 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.cZNq98 + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.2.3 + /usr/bin/unzip -qq /builddir/build/SOURCES/bowtie-src-x86_64.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.2.3 + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + echo 'Patch #0 (bowtie-enable-multi-arch.patch):' Patch #0 (bowtie-enable-multi-arch.patch): + /usr/bin/patch --no-backup-if-mismatch -p1 -b --suffix .bowtie-enable-multi-arch.patch --fuzz=0 patching file Makefile Patch #2 (bowtie-alphabet-error-narrowing.patch): + echo 'Patch #2 (bowtie-alphabet-error-narrowing.patch):' + /usr/bin/patch --no-backup-if-mismatch -p1 -b --suffix .bowtie-alphabet-error-narrowing.patch --fuzz=0 patching file alphabet.cpp patching file alphabet.h + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -i '1s|/usr/bin/env python|/usr/bin/python3.6|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -i '1s|/usr/bin/env python|/usr/bin/python3.6|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -i '1s|/usr/bin/env python|/usr/bin/python3.6|' bowtie-inspect + sed -i 's/“/"/g' processor_support.h + sed -i 's/”/"/g' processor_support.h + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.P8KItd + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.2.3 + export POPCNT_CAPABILITY=0 + POPCNT_CAPABILITY=0 + export NO_TBB=1 + NO_TBB=1 + /usr/bin/make -O -j12 allall EXTRA_FLAGS=-g g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from bowtie_inspect.cpp:10: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from bowtie_inspect.cpp:10: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from bowtie_inspect.cpp:10: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from bowtie_inspect.cpp:10: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from bowtie_inspect.cpp:10: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from bowtie_inspect.cpp:10: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_build.cpp:11: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt_build.cpp:11: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_build.cpp:11: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_build.cpp:11: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_build.cpp:11: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Alloc >; TIndexOffU = unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] for (int i = 0; i < length(_sampleSuffs) + 1; i++) { ~~^~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from ebwt_build.cpp:9: blockwise_sa.h: In instantiation of 'void KarkkainenBlockwiseSA::nextBlock(int, int) [with TStr = seqan::String, seqan::Alloc >]': blockwise_sa.h:978:6: required from here assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:981:3: note: in expansion of macro 'assert_lt' assert_lt(tid, length(this->_itrBuckets)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:991:2: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:1062:5: note: in expansion of macro 'assert_lt' assert_lt(cur_block, length(_sampleSuffs)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:1073:5: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Packed<> >; TIndexOffU = unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] for (int i = 0; i < length(_sampleSuffs) + 1; i++) { ~~^~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from ebwt_build.cpp:9: blockwise_sa.h: In instantiation of 'void KarkkainenBlockwiseSA::nextBlock(int, int) [with TStr = seqan::String, seqan::Packed<> >]': blockwise_sa.h:366:16: required from here assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:981:3: note: in expansion of macro 'assert_lt' assert_lt(tid, length(this->_itrBuckets)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:991:2: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:1062:5: note: in expansion of macro 'assert_lt' assert_lt(cur_block, length(_sampleSuffs)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:1073:5: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_build.cpp:11: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt_build.cpp:11: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_build.cpp:11: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_build.cpp:11: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from ebwt_build.cpp:9: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_build.cpp:11: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Alloc >; TIndexOffU = long unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] for (int i = 0; i < length(_sampleSuffs) + 1; i++) { ~~^~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from ebwt_build.cpp:9: blockwise_sa.h: In instantiation of 'void KarkkainenBlockwiseSA::nextBlock(int, int) [with TStr = seqan::String, seqan::Alloc >]': blockwise_sa.h:978:6: required from here assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:981:3: note: in expansion of macro 'assert_lt' assert_lt(tid, length(this->_itrBuckets)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:991:2: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:1062:5: note: in expansion of macro 'assert_lt' assert_lt(cur_block, length(_sampleSuffs)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:1073:5: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Packed<> >; TIndexOffU = long unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] for (int i = 0; i < length(_sampleSuffs) + 1; i++) { ~~^~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from ebwt_build.cpp:9: blockwise_sa.h: In instantiation of 'void KarkkainenBlockwiseSA::nextBlock(int, int) [with TStr = seqan::String, seqan::Packed<> >]': blockwise_sa.h:366:16: required from here assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:981:3: note: in expansion of macro 'assert_lt' assert_lt(tid, length(this->_itrBuckets)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:991:2: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ assert_helpers.h:176:9: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!(a < b)) { \ ~~~^~~~ blockwise_sa.h:1062:5: note: in expansion of macro 'assert_lt' assert_lt(cur_block, length(_sampleSuffs)); ^~~~~~~~~ assert_helpers.h:207:11: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] if(!((a) <= (b))) { \ ~~~~~^~~~~~~ blockwise_sa.h:1073:5: note: in expansion of macro 'assert_leq' assert_leq(cur_block, length(_sampleSuffs)); ^~~~~~~~~~ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from bowtie_inspect.cpp:10: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from bowtie_inspect.cpp:10: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from bowtie_inspect.cpp:10: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from bowtie_inspect.cpp:10: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from bowtie_inspect.cpp:10: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from bowtie_inspect.cpp:10: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from bowtie_inspect.cpp:10: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from bowtie_inspect.cpp:8: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from bowtie_inspect.cpp:10: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_build.cpp:11: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt.h:39, from ebwt_build.cpp:11: reference.h: In member function 'int BitPairReference::getStretch(uint32_t*, size_t, size_t, size_t) const': reference.h:534:13: warning: variable 'origBufOff' set but not used [-Wunused-but-set-variable] uint64_t origBufOff = bufOff; ^~~~~~~~~~ In file included from ebwt_build.cpp:11: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Alloc >; TIndexOffU = unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] for (int i = 0; i < length(_sampleSuffs) + 1; i++) { ~~^~~~~~~~~~~~~~~~~~~~~~~~~~ blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Packed<> >; TIndexOffU = unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size > >::Type' {aka 'long unsigned int'} [-Wsign-compare] g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_build.cpp:11: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_build.cpp:11: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt.h:39, from ebwt_build.cpp:11: reference.h: In member function 'int BitPairReference::getStretch(uint32_t*, size_t, size_t, size_t) const': reference.h:534:13: warning: variable 'origBufOff' set but not used [-Wunused-but-set-variable] uint64_t origBufOff = bufOff; ^~~~~~~~~~ In file included from ebwt_build.cpp:11: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from ebwt.h:27, from ebwt_build.cpp:11: blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Alloc >; TIndexOffU = long unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] for (int i = 0; i < length(_sampleSuffs) + 1; i++) { ~~^~~~~~~~~~~~~~~~~~~~~~~~~~ blockwise_sa.h: In instantiation of 'TIndexOffU KarkkainenBlockwiseSA::nextSuffix() [with TStr = seqan::String, seqan::Packed<> >; TIndexOffU = long unsigned int]': blockwise_sa.h:295:23: required from here blockwise_sa.h:305:26: warning: comparison of integer expressions of different signedness: 'int' and 'seqan::Size >::Type' {aka 'long unsigned int'} [-Wsign-compare] g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp color.cpp color_dec.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_search.cpp:21: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_search.cpp:21: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt_search.cpp:21: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_search.cpp:21: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_search.cpp:21: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_search.cpp:21: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ pat.cpp: In member function 'std::pair PatternSourcePerThread::nextReadPair()': pat.cpp:109:36: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] bool this_is_last = buf_.cur_buf_ == last_batch_size_-1; ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:711:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff - trim3; i++) { ~~^~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaContinuousPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:889:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff; i++) { ~~^~~~~~~~ In file included from ebwt_search_util.h:9, from ebwt_search_util.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from sam.cpp:12: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from hit.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp color.cpp color_dec.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_search.cpp:21: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_search.cpp:21: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt_search.cpp:21: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::free(T*, uint32_t) [with T = Edit; uint32_t = unsigned int]': range_source.h:138:75: required from here pool.h:306:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, num * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'void AllocOnlyPool::free(T*) [with T = Branch]': range_source.h:789:18: required from here pool.h:286:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(&pools_[curPool_][cur_], 0, sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_search.cpp:21: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Edit]': pool.h:238:7: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Edit]': pool.h:240:8: required from 'T* AllocOnlyPool::alloc(uint32_t) [with T = Edit; uint32_t = unsigned int]' range_source.h:41:40: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'struct Edit'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from hit_set.h:16, from pat.h:22, from sequence_io.h:12, from multikey_qsort.h:8, from diff_sample.h:13, from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: edit.h:31:8: note: 'struct Edit' declared here struct Edit { ^~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::lazyInit() [with T = Branch]': pool.h:215:7: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:367:22: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_search.cpp:21: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ In file included from alphabet.h:9, from ebwt_search.cpp:18: pool.h: In instantiation of 'bool AllocOnlyPool::allocNextPool() [with T = Branch]': pool.h:217:8: required from 'T* AllocOnlyPool::alloc() [with T = Branch]' range_source.h:658:35: required from here pool.h:347:21: warning: 'void* memset(void*, int, size_t)' clearing an object of non-trivial type 'class Branch'; use assignment or value-initialization instead [-Wclass-memaccess] ASSERT_ONLY(memset(pool, 0, lim_ * sizeof(T))); ~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ assert_helpers.h:21:27: note: in definition of macro 'ASSERT_ONLY' #define ASSERT_ONLY(x...) x ^ In file included from ebwt_search_backtrack.h:10, from ebwt.h:1680, from ebwt_search.cpp:21: range_source.h:516:7: note: 'class Branch' declared here class Branch { ^~~~~~ pat.cpp: In member function 'std::pair PatternSourcePerThread::nextReadPair()': pat.cpp:109:36: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] bool this_is_last = buf_.cur_buf_ == last_batch_size_-1; ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:711:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff - trim3; i++) { ~~^~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaContinuousPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:889:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff; i++) { ~~^~~~~~~~ In file included from ebwt_search_util.h:9, from ebwt_search_util.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from sam.cpp:12: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from hit.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp color.cpp color_dec.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_search.cpp:21: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_search.cpp:21: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt.h:39, from ebwt_search.cpp:21: reference.h: In member function 'int BitPairReference::getStretch(uint32_t*, size_t, size_t, size_t) const': reference.h:534:13: warning: variable 'origBufOff' set but not used [-Wunused-but-set-variable] uint64_t origBufOff = bufOff; ^~~~~~~~~~ In file included from ebwt_search.cpp:21: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ pat.cpp: In member function 'std::pair PatternSourcePerThread::nextReadPair()': pat.cpp:109:36: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] bool this_is_last = buf_.cur_buf_ == last_batch_size_-1; ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:711:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff - trim3; i++) { ~~^~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaContinuousPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:889:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff; i++) { ~~^~~~~~~~ In file included from ebwt_search_util.h:9, from ebwt_search_util.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from sam.cpp:12: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from hit.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"`date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder -Wno-unused-local-typedefs \ -isystem ./SeqAn-1.1 \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp color.cpp color_dec.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread In file included from blockwise_sa.h:19, from ebwt.h:27, from ebwt_search.cpp:21: diff_sample.h: In function 'void calcExhaustiveDC(T, bool, bool)': diff_sample.h:162:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~ diff_sample.h:162:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d1]) diffCnt++; diffs[d1] = true; ^~~~~ diff_sample.h:163:6: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~ diff_sample.h:163:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(!diffs[d2]) diffCnt++; diffs[d2] = true; ^~~~~ In file included from ebwt.h:27, from ebwt_search.cpp:21: blockwise_sa.h: In destructor 'KarkkainenBlockwiseSA::~KarkkainenBlockwiseSA()': blockwise_sa.h:212:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~ blockwise_sa.h:212:32: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_dc != NULL) delete _dc; _dc = NULL; // difference cover sample ^~~ In file included from ebwt.h:31, from ebwt_search.cpp:21: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from ebwt.h:39, from ebwt_search.cpp:21: reference.h: In member function 'int BitPairReference::getStretch(uint32_t*, size_t, size_t, size_t) const': reference.h:534:13: warning: variable 'origBufOff' set but not used [-Wunused-but-set-variable] uint64_t origBufOff = bufOff; ^~~~~~~~~~ In file included from ebwt_search.cpp:21: ebwt.h: In destructor 'Ebwt::~Ebwt()': ebwt.h:843:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~ ebwt.h:843:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_fchr != NULL) delete[] _fchr; _fchr = NULL; ^~~~~ ebwt.h:844:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~ ebwt.h:844:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_ftab != NULL) delete[] _ftab; _ftab = NULL; ^~~~~ ebwt.h:845:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~ ebwt.h:845:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_eftab != NULL) delete[] _eftab; _eftab = NULL; ^~~~~~ ebwt.h:851:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_isa != NULL) delete[] _isa; _isa = NULL; ^~ ebwt.h:851:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_isa != NULL) delete[] _isa; _isa = NULL; ^~~~ ebwt.h:852:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_plen != NULL) delete[] _plen; _plen = NULL; ^~ ebwt.h:852:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_plen != NULL) delete[] _plen; _plen = NULL; ^~~~~ ebwt.h:853:4: warning: this 'if' clause does not guard... [-Wmisleading-indentation] if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~ ebwt.h:853:44: note: ...this statement, but the latter is misleadingly indented as if it were guarded by the 'if' if(_rstarts != NULL) delete[] _rstarts; _rstarts = NULL; ^~~~~~~~ pat.cpp: In member function 'std::pair PatternSourcePerThread::nextReadPair()': pat.cpp:109:36: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] bool this_is_last = buf_.cur_buf_ == last_batch_size_-1; ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:711:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff - trim3; i++) { ~~^~~~~~~~~~~~~~~~ pat.cpp: In member function 'virtual bool FastaContinuousPatternSource::parse(Read&, Read&, TReadId) const': pat.cpp:889:22: warning: comparison of integer expressions of different signedness: 'size_t' {aka 'long unsigned int'} and 'int' [-Wsign-compare] for(size_t i = 0; i < seqoff; i++) { ~~^~~~~~~~ In file included from ebwt_search_util.h:9, from ebwt_search_util.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from sam.cpp:12: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { In file included from hit.cpp:1: hit.h: In member function 'void HitSink::maybeFlush(size_t)': hit.h:580:26: warning: comparison of integer expressions of different signedness: '__gnu_cxx::__alloc_traits, long unsigned int>::value_type' {aka 'long unsigned int'} and 'int' [-Wsign-compare] if(ptCounts_[threadId] >= perThreadBufSize_) { + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.vtIFI7 + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 + cd bowtie-1.2.3 + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 'INSTALL=/usr/bin/install -p' prefix=/usr DESTDIR=/builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 mkdir -p /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64//usr/bin/ + /usr/lib/rpm/find-debuginfo.sh -j12 --strict-build-id -m -i --build-id-seed 1.2.3-2.el8 --unique-debug-suffix -1.2.3-2.el8.aarch64 --unique-debug-src-base bowtie-1.2.3-2.el8.aarch64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 50000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.2.3 extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-align-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-align-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-align-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-align-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-build-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-build-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-build-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-build-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-inspect-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-inspect-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-inspect-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/bin/bowtie-inspect-s-debug /usr/lib/rpm/sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. 6391 blocks + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig /sbin/ldconfig: Warning: ignoring configuration file that cannot be opened: /etc/ld.so.conf: No such file or directory + /usr/lib/rpm/brp-compress + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/brp-python-bytecompile '' 1 + /usr/lib/rpm/brp-python-hardlink + PYTHON3=/usr/bin/python3.6 + /usr/lib/rpm/redhat/brp-mangle-shebangs Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.hrdNHR + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.2.3 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.2.3' /builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s version 1.2.3 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.2.3' bowtie-build version 1.2.3 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.2.3' bowtie-inspect version 1.2.3 + tar xzvf /builddir/build/SOURCES/bowtie-1.2.3-tests.tgz scripts/test/ scripts/test/random_bowtie_tests.sh scripts/test/large_idx.py scripts/test/build_big.py scripts/test/btdata.py scripts/test/cs_trim.pl scripts/test/random_bowtie_tests_p.sh scripts/test/cs_dec.pl scripts/test/all.sh scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/DNA.pm scripts/test/dataface.py scripts/test/random_bowtie_tests.pl scripts/test/inspect.pl scripts/test/args.pl scripts/test/btface.py scripts/test/long_read.pl scripts/test/samtools.pl scripts/test/simple_tests.pl + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests @HD VN:1.0 SO:unsorted # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" %) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Reported 1 alignments Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 100.00%) No alignments Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 100.00%) No alignments Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie --debug -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie --debug -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 3 # reads with at least one reported alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 %) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 alignments Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 alignments Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 0 (0.00%) Reported 1 alignments Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 0.00%) Reported 1 alignments Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 100.00%) No alignments Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-s --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 %) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie --debug --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie --debug --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l-debug --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests @HD VN:1.0 SO:unsorted # reads processed: 3 # reads with at least one reported alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 2 # reads with at least one reported alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 0 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted # reads processed: 2 # reads with at least one reported alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 TTGTTCGT IIIIIIII XM:i:2 Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 ACGAACAA IIIIIIII XM:i:2 0.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace 1 (fw:1, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace 1 (fw:0, sam:1) References: >0 AAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 4 255 17M * 0 0 CGAAAGCTTTTATAGAT qqqqqqqqqqqqqqqqq XA:i:0 MD:Z:17 NM:i:0 CM:i:0 XM:i:2 Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTA (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Reported 1 alignments Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTA with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ - seq + 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 (0.00%) Reported 1 alignments Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ - seq + 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 0.00%) Reported 1 alignments Colorspace FASTQ with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace Tabbed with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace raw (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace raw with primer (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 5 255 17M * 0 0 CGAAAGCTTGTATAGAT qqqqqqqqqqqqqqqqq XA:i:2 MD:Z:9T7 NM:i:1 CM:i:2 XM:i:2 Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGAAGTGACCTTTGGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 4 * 0 0 * * 0 0 CTGGTTTCCAGTGAAGTC IIIIIIIIIIIIIIIIII XM:i:0 Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --large-index --threads 1 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie --large-index -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 Colorspace 4 (fw:1, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie-build --large-index --threads 2 --quiet --sanity -C .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 Colorspace 4 (fw:0, sam:1) References: >0 ATATATGTCGACATATATATATATAT ./bowtie --large-index -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one reported alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:26 @PG ID:Bowtie VN:1.2.3 CL:"/builddir/build/BUILD/bowtie-1.2.3/bowtie-align-l --wrapper basic-0 -C -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 5 255 15M * 0 0 ATGTCGACATATATA qqqqqqqqqqqqqqq XA:i:0 MD:Z:15 NM:i:0 CM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + exit 0 Processing files: bowtie-1.2.3-2.el8.aarch64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.B0yZNg + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.2.3 + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + export LC_ALL=C + LC_ALL=C + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + cp -pr MANUAL /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + cp -pr NEWS /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + cp -pr VERSION /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + cp -pr AUTHORS /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + cp -pr TUTORIAL /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + cp -pr doc/manual.html doc/style.css /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/doc/bowtie + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.3ZPO3h + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.2.3 + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/licenses/bowtie + export LC_ALL=C + LC_ALL=C + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/licenses/bowtie + cp -pr LICENSE /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/licenses/bowtie + cp -pr SeqAn-1.1/GPL.txt SeqAn-1.1/LGPL.txt /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64/usr/share/licenses/bowtie + exit 0 Provides: bowtie = 1.2.3-2.el8 bowtie(aarch-64) = 1.2.3-2.el8 bundled(seqan) = 1.1 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /bin/bash /bin/sh /usr/bin/perl /usr/bin/python3.6 libc.so.6()(64bit) libc.so.6(GLIBC_2.17)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.17)(64bit) libm.so.6(GLIBC_2.27)(64bit) libpthread.so.0()(64bit) libpthread.so.0(GLIBC_2.17)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.2.3-2.el8.aarch64 Provides: bowtie-debugsource = 1.2.3-2.el8 bowtie-debugsource(aarch-64) = 1.2.3-2.el8 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.2.3-2.el8.aarch64 Provides: bowtie-debuginfo = 1.2.3-2.el8 bowtie-debuginfo(aarch-64) = 1.2.3-2.el8 debuginfo(build-id) = 09e29b3d32b2eeb26299b900dbb8d80ab5df4b54 debuginfo(build-id) = 3baf7d6d3d36e656d97b4a4355168eaaf92b963b debuginfo(build-id) = 45ee079ddf6811582ae6b1b35aa88ea781e219f8 debuginfo(build-id) = 51278619171d40bdab6496e9a4fbe9d9b16a7345 debuginfo(build-id) = 71b23c639dff36a5624bbcde35c519c6a3307bda debuginfo(build-id) = 9ee312af3caaa5a737507f942133315cfd23858d debuginfo(build-id) = a2ba500b35b1535a70a034afa7efb73c6339daf4 debuginfo(build-id) = a94ea3a8553a43fd60f9c6ca3cd661ed23d65ca4 debuginfo(build-id) = b448541e33e456581e8d3edd4f57800300fc58ec debuginfo(build-id) = b5ae2003e98d57498786f7eba85db619c6ac8cbf debuginfo(build-id) = f42a052f30007ccd7f35fc611030667e7df4962a debuginfo(build-id) = f968fe75415550db01b200244419ff4e75d41375 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(aarch-64) = 1.2.3-2.el8 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.2.3-2.el8.aarch64 Wrote: /builddir/build/RPMS/bowtie-1.2.3-2.el8.aarch64.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.2.3-2.el8.aarch64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.2.3-2.el8.aarch64.rpm Child return code was: 0